mRNA Plasmid Templates: Key Elements and Design Strategies

Creating mRNA for vaccines or therapies starts with a well-designed plasmid template. Here’s a quick guide to the key elements and how they’re optimized for success.

The Promoter: Where Transcription Begins

The T7 promoter is the most popular choice for starting mRNA synthesis. Its classic sequence, “TAATACGACTCACTATAGGG,” ensures efficient transcription. Over time, scientists have developed variations like the GG, AG, and AT/AU templates to work with advanced capping systems, such as CleanCap or self-amplifying RNA platforms.

Linearization: Cutting the Plasmid for Precision

To stop the plasmid from endlessly transcribing, it needs to be cut at a specific site. Type IIS enzymes, like BspQⅠ or BsaⅠ, are perfect for this job. They snip the DNA outside their recognition sequence, leaving no extra bits behind and preserving the crucial polyA tail.

The mRNA Blueprint: Building Blocks of Success

The mRNA sequence includes a 5’ cap, untranslated regions (UTRs), a coding sequence (CDS), and a polyA tail. Here’s how each part is designed:

• UTRs: These can be borrowed from highly expressed natural genes (like those in viruses) or custom-designed using advanced algorithms for better performance.
• CDS: Scientists first design the protein sequence, then optimize the DNA code for efficient expression.
• PolyA Tail: A stretch of 100–120 adenines, or a segmented version like 30A + Linker + 70A, ensures the mRNA stays stable and functional.

By mastering these elements, researchers can create powerful mRNA templates for everything from vaccines to cutting-edge therapies. The future of medicine starts here!

Yaohai Bio-Pharma, is a platform enterprise specializing in services for microbial expression systems. Drawing on a decade of expertise, Yaohai has developed a comprehensive suite of GMP-compliant technologies for synthesizing linear and circular mRNA, offering high-quality RNA products that encompass sequence design and optimization, gene synthesis, in vitro transcription (IVT), circularization, RNA purification, and LNP encapsulation.

We are also actively seeking institutional or individual global partners. We offer the most competitive compensation in the industry. If you have any questions, please feel free to contact us: [email protected]